Wikipedia:Reference desk/Archives/Science/2018 June 29
| Science desk | ||
|---|---|---|
| < June 28 | << May | June | Jul >> | June 30 > |
| Welcome to the Wikipedia Science Reference Desk Archives |
|---|
| The page you are currently viewing is an archive page. While you can leave answers for any questions shown below, please ask new questions on one of the current reference desk pages. |
June 29
[edit]Car sound getting louder
[edit]You are standing on the side of a road in the countryside. A car passes. It goes whooooosh. The sound fades and fades as the car goes away. Then, after it is off in the distance, the sound gets louder again. What is that about? Anna Frodesiak (talk) 10:26, 29 June 2018 (UTC)
- Could be several things -- car accelerating rapidly, noise being focused by reverberation from obstacles (deep cutting, rows of buildings, etc.), and so on. 2601:646:8A00:A0B3:157E:9722:AD27:3562 (talk) 10:59, 29 June 2018 (UTC)
- The observations of the different levels of sound emanating from the Mount Saint Helens eruption of 1980 may be related. ←Baseball Bugs What's up, Doc? carrots→ 11:16, 29 June 2018 (UTC)
- There's not enough information in the question. Terrain? Weather/wind? HiLo48 (talk) 11:30, 29 June 2018 (UTC)
This happens every time on any fairly straight, flat road. It happens regardless of things on the side of the road. I'm not sure about wind. The car doesn't accelerate once off in the distance.
Surely, some of you must have noticed this.
Anna Frodesiak (talk) 20:59, 29 June 2018 (UTC)
- WP:OR alert: I've noticed that sometimes I can quite clearly hear a distant train in the middle of the night, other times not. I concluded that I can hear it when there is cloud cover, and the sound reflects off the cloud layer and the "direct" sound is muffled by trees n'stuff. —107.15.157.44 (talk) 21:19, 29 June 2018 (UTC)
- Interesting. Anna Frodesiak (talk) 21:25, 29 June 2018 (UTC)
- Similar phenomenon: I live not right next to, but a few blocks from a freeway. During the day you can never hear it, but at night you can hear the vehicle sounds with the windows open. I presume this has something to do with air currents. The air probably rises during the day so the sound doesn't travel, but at night, if it's calm, the sound can travel some distance. --47.146.63.87 (talk) 06:29, 30 June 2018 (UTC)
- Also there might be less other ambient/background sound (similar to white noise effect) during the night to mask it. I've noticed similar effects during a recent power outage, the road construction project a few blocks away seemed unusually loud (as it also does at night). DMacks (talk) 07:33, 2 July 2018 (UTC)
I'm going to video this next time I'm in the countryside (where it's quiet), and then post the video here. Anna Frodesiak (talk) 21:25, 29 June 2018 (UTC)
Maybe the air carries more energy to your ears after the car's low pressure slipstream passes by? Or perhaps a whispering gallery effect of some kind involving reflection off cloud cover, as 107.15.157.44 suggests. A quick web search on acoustic wakes found this, no idea if it's relevant, but apparently the sound wakes of aircraft are spread over many miles. 173.228.123.166 (talk) 23:40, 29 June 2018 (UTC)
- Perhaps some sort of lensing effect from heat rising from the pavement, a sound mirage, as it were? Abductive (reasoning) 20:02, 30 June 2018 (UTC)
Okay, I have someone who is off to the countryside who will try to take a video with audio. They have instructions. We'll get to the bottom of this. Cheers, Anna Frodesiak (talk) 10:34, 2 July The
- See the article on acoustic reflex which protects both ears from loud sounds. A passing car in an otherwise quiet environment is certainly loud enough to trigger the reflex, reducing the sound conducted to your inner ears. Then as the vehicle's sound diminishes your ears can become more sensitive again increasing the sound conduction back to normal (barring a lot of traffic with other loud sounds triggering it again). Should the traffic's sound be temporally dampened by the reflex this will of course not show up on a video mic. A quick internet search didn't turned up any relevant research regarding listening to light traffic, or I'd link to it. However, it seems that I've noticed this effect too where I live when I was considerably younger (I've tinnitus in my left ear now) and when there was far less traffic, about one car per hour instead of every few seconds... and it's fairly hilly here which may make it far less obvious. --Modocc (talk) 16:55, 2 July 2018 (UTC)
- Interesting, Modocc, and maybe easy to test. I'll try to cover my ears when it passes next time I'm on a quiet road. I'll uncover my ears right after then wait till it's in the distance and see if it gets louder again. Anna Frodesiak (talk) 17:10, 2 July 2018 (UTC)
- Good idea. -Modocc (talk) 19:00, 2 July 2018 (UTC)
- If you do record it, for the same reason, you may want to use a microphone which has a wide enough dynamic range, a system with enough "headroom" and disable any volume normalization or compression effects/software. This ear protection hypothesis was also my first guess but it seems unlikely unless the sound is quite loud when close. But if the environment is so silent as to be able to hear tinnitus with some focus, then this is very likely. Even young ears without damage can hear noise in very silent environments, the brain is also capable of producing some when there's not enough signal from the ear itself. —PaleoNeonate – 13:20, 5 July 2018 (UTC)
- Noted, thank you, PaleoNeonate. :) Anna Frodesiak (talk) 17:38, 5 July 2018 (UTC)
- Interesting, Modocc, and maybe easy to test. I'll try to cover my ears when it passes next time I'm on a quiet road. I'll uncover my ears right after then wait till it's in the distance and see if it gets louder again. Anna Frodesiak (talk) 17:10, 2 July 2018 (UTC)
Well, the person did not do it. I will try myself when I can.
I suggest, if you are science-minded, that you go out on the street when it is quiet and see for yourself. I'm sure you will agree that this is not imaginary, nor something to do with the listener. This is some sort of effect. Anna Frodesiak (talk) 17:38, 5 July 2018 (UTC)
- It's not an effect that I have observed. Are you sure that it's not just that you expect the volume to reduce, and it doesn't reduce as much as you expected? Dbfirs 20:19, 5 July 2018 (UTC)
- Hi Dbfirs. I am sure. Really, try it and see. Wait till the car is about 100 m down the road and it will get louder again. I'll try it when I'm in a quiet place. I cannot do it now because I'm in downtown China where it is never, ever, ever, ever quiet. Anna Frodesiak (talk) 15:54, 6 July 2018 (UTC)
Determine whether DNA sequence is intron or exon
[edit]I'm trying to determine whether the following sequence which comes from a gene for a protein called Mad1 is from an exon, intron or part of both. The numbers that the BLAST alignment tool gives are not the same as what Ensembl gives
aatctcttacatcatactttgaagcttgccaaaatctgatgcttcagatgtactgcaacaaccagtttctgagacaggtccttcgcaagcaaaaatcttcatacttcagtgtcagacaggaaaagaaaccagagattctcccagctgctttaccaggggatgaggttacttctcaaacaatcagaccttgagtcctcacactgccactgctacacagcaccccaaacaatgcaattgttaatgccggctatgaagcaggaagggaaggaagatgaggaaaagtatttactttttatcttgtctgaaactccttcaggacttcaggcaaacggtattgctcaatccatccttgcttaattcatctcatggaactcttgaatggtacccaggcaataggctggctctccacagagatggaaattacatctctaattacaagatacagtgctgccctaataataagtactgtgctcaagaagtcccc
Can anyone advise how to determine whether it's intronic or... exonic? (is that a word?) 129.215.47.59 (talk) 13:33, 29 June 2018 (UTC)
- Blast is defaulting to aligning that piece of DNA to an older, fragmented assembly for some reason. if you force it to search within RefSeq Genomes, you will get back the correct chromosome, but blast puts this piece of dna as laying entirely outside of your gene. You know, unless it's regulatory. Someguy1221 (talk) 04:32, 2 July 2018 (UTC)