Human identical sequence
Appearance
The human identical sequence (HIS) is a sequence of RNA elements, 24-27 nucleotides in length, that coronavirus genomes share with the human genome.[1] In pathogenic progression, HIS acts as a NamiRNA (nuclear activating miRNA) through the NamiRNA-enhancer network to activate neighboring host genes.[2][3] The first HIS elements was identified in the SARS-CoV-2 genome, which has five HIS elements; other human coronaviruses have one to five.[1] It has been suggested that these sequences can be more generally termed "host identical sequences" since similar correlations have been found between the genome of SARS-CoV-2 and multiple potential hosts (bats, pangolins, ferrets, and cats).[1]
SARS-CoV-2
[edit]| name | length | sequence | location in virus genome | location in human genome | neighboring genes | note |
|---|---|---|---|---|---|---|
| HIS-SARS2-1 | 26 | UGUCUAUGCUAAUGGAGGUAAAGGCU | 7570–7595 in ORF1a | Chr3: 124017420-124017395 | KALRN | |
| HIS-SARS2-2 | 24 | UAUAACACAUATAAAAAUACGUGU | 12494–12517 in ORF1a | Chr3: 176597319-176597342 | ||
| HIS-SARS2-3 | 24 | UUAUAUGCCUUAUUUCUUUACUUU | 6766–6789 in ORF1a | Chr5: 28949255-28949232 | ||
| HIS-SARS2-4 | 27 | AGGAGAAUGACAAAAAAAAAAAAAAAA | 29860–29886 in 3' UTR | Chr18: 73670168-73670142 | FBXO15, TIMM21, CYB5A | same as HIS-SARS1-2 |
| HIS-SARS2-5 | 24 | UUGUUGCUGCUAUUUUCUAUUUAA | 8610–8633 in ORF1a | ChrX: 99693480-99693457 |
SARS-CoV-1
[edit]| name | length | sequence | location in virus genome | location in human genome | neighboring genes | note |
|---|---|---|---|---|---|---|
| HIS-SARS-1 | 25 | UAACAUGCUUAGGAUAAUGGCCUCU | 15251–15275 in ORF1b | Chr4: 172887105–172887129 Chr8: 122356667-122356690 | HAS2, ZHX2 | |
| HIS-SARS-2 | 27 | AGGAGAAUGACAAAAAAAAAAAAAAAA | 29717–29743 in 3' UTR | Chr18: 73670168-73670142 | same as HIS-SARS2-4 |
MERS-CoV
[edit]| name | length | sequence | location in virus genome | location in human genome | neighboring genes | note |
|---|---|---|---|---|---|---|
| HIS-MERS-1 | 24 | UUCCAUUUGCACAGAGUAUCUUUU | 24364–24387 in S | ChrX: 25635779-25635802 |
HCoV-HKU1
[edit]| name | length | sequence | location in virus genome | location in human genome | neighboring genes | note |
|---|---|---|---|---|---|---|
| HIS-HKU1-1 | 24 | UUAGAAUUGUUCAAAUGUUAUCUG | 18656-18679 | chr1:106816197-106816220 | ||
| HIS-HKU1-2 | 24 | UUUUCUAAGAAAGAUUGGUAUGAU | 14044-14067 | chr1:226438633-226438656 chr4:151100495-151100518 chr5:79284823-79284846 chr5:111192947-111192970 chr7:94695722-94695745 chr7:98386489-98386512 chr15:59768424-59768447 chr22:30137367-30137390 | ||
| HIS-HKU1-3 | 24 | AUUUGACUUUAAAUCUUCAUACUA | 26693-26716 | chr4:11718458-11718481 | ||
| HIS-HKU1-4 | 24 | GAUUGGUUGUAUUUUCAUUUUUAU | 23527-23550 | chr4:33759646-33759669 | ||
| HIS-HKU1-5 | 24 | UAGAUACUGUUAUUUUUAAAAAUA | 19844-19867 | chrX:81711130-81711153 |
HCoV-NL63
[edit]| name | length | sequence | location in virus genome | location in human genome | neighboring genes | note |
|---|---|---|---|---|---|---|
| HIS-NL63-1 | 24 | UUAUGAUUUUGGUGAUUUUGUUGU | 13044-13067 | chr1:215311768-215311791 | ||
| HIS-NL63-2 | 24 | GGUGUUUUUGUUGAUGAUGUUGUU | 14920-14943 | chr4:28254452-28254475 | ||
| HIS-NL63-3 | 24 | AUAGGCUUAAAUGCUUCUGUUACU | 20754-20777 | chr6:30469931-30469954 | ||
| HIS-NL63-4 | 24 | AAGUAAUUGUAUUAAGAUGUUAUC | 12124-12147 | chr7:19853545-19853568 | ||
| HIS-NL63-5 | 24 | AACUUUUAUGAUUUUGGUGAUUUU | 13039-13062 | chr9:1525276-1525299 |
HCoV-OC43
[edit]| name | length | sequence | location in virus genome | location in human genome | neighboring genes | note |
|---|---|---|---|---|---|---|
| HIS-OC43-1 | 24 | UACAGCUCUUUGUAAAUCUGGUAG | 22827-22850 | chr8:122471006-122471029 | HAS2, ZHX2 | |
| HIS-OC43-2 | 24 | UUGUAUGAGUGAUUUUAUGAGUGA | 24509-24532 | chr13:30510223-30510246 |
HCoV-229E
[edit]| name | length | sequence | location in virus genome | location in human genome | neighboring genes | note |
|---|---|---|---|---|---|---|
| HIS-229E-1 | 24 | AAUAUUUUAACAGUACCACGUUAU | 19817-19840 | chr8:42865576-42865599 | ||
| HIS-229E-2 | 24 | ACUUUGUAUUGUGUCCUCCUGGAA | 13139-13162 | chr11:112451251-112451274 |
References
[edit]- 1 2 3 Li, W; Yang, S; Xu, P; Zhang, D; Tong, Y; Chen, L; Jia, B; Li, A; Lian, C; Ru, D; Zhang, B; Liu, M; Chen, C; Fu, W; Yuan, S; Gu, C; Wang, L; Li, W; Liang, Y; Yang, Z; Ren, X; Wang, S; Zhang, X; Song, Y; Xie, Y; Lu, H; Xu, J; Wang, H; Yu, W (February 2022). "SARS-CoV-2 RNA elements share human sequence identity and upregulate hyaluronan via NamiRNA-enhancer network". EBioMedicine. 76 103861. doi:10.1016/j.ebiom.2022.103861. PMC 8811534. PMID 35124429.
- ↑ Yang, S; Ling, Y; Zhao, F; Li, W; Song, Z; Wang, L; Li, Q; Liu, M; Tong, Y; Chen, L; Ru, D; Zhang, T; Zhou, K; Zhang, B; Xu, P; Yang, Z; Li, W; Song, Y; Xu, J; Zhu, T; Shan, F; Yu, W; Lu, H (18 March 2022). "Hymecromone: a clinical prescription hyaluronan inhibitor for efficiently blocking COVID-19 progression". Signal Transduction and Targeted Therapy. 7 (1): 91. doi:10.1038/s41392-022-00952-w. PMC 8931182. PMID 35304437.
- ↑ Xiao M, Li J, Li W, Wang Y, Wu F, Xi Y, Zhang L, Ding C, Luo H, Li Y, Peng L, Zhao L, Peng S, Xiao Y, Dong S, Cao J, Yu W (October 2017). "MicroRNAs activate gene transcription epigenetically as an enhancer trigger". RNA Biology. 14 (10): 1326–1334. doi:10.1080/15476286.2015.1112487. PMC 5711461. PMID 26853707.