Edge Rewrite
// HTMLRewriter · presentation

This page was redesigned at the edge.

Cloudflare fetched the original article and streamed it through HTMLRewriter to apply an entirely new visual system without rebuilding the source page.

Jump to content

Icerudivirus

From Wikipedia, the free encyclopedia
(Redirected from Rudivirus)

Icerudivirus
Rudiviridae virion
Virus classification Edit this classification
(unranked): Virus
Realm: Adnaviria
Kingdom: Zilligvirae
Phylum: Taleaviricota
Class: Tokiviricetes
Order: Ligamenvirales
Family: Rudiviridae
Genus: Icerudivirus

Icerudivirus is a genus of viruses in the family Rudiviridae. These viruses are non-enveloped, stiff-rod-shaped viruses with linear dsDNA genomes, that infect hyperthermophilic archaea of the species Sulfolobus islandicus.[1][2] There are three species in the genus.[3]

Taxonomy

[edit]

The following species are assigned to the genus:[3]

Icerudivirus was previously named Rudivirus but was renamed in 2020.[7]

Discovery

[edit]

SIRV1 and SIRV2 were produced by colony-cloned Sulfolobus islandicus strains. The two strains were isolated from samples taken in 1994 from different solfataric fields in Iceland, the Kverkfjöll and Hveragerði, which are separated by a distance of 250 km. These Icelandic solfataric acidic hot springs reach a temperature of 88 °C and pH 2.5.[8]

Structure

[edit]

Virions are non-enveloped, consisting of a tube-like superhelix formed by dsDNA and the major structural protein, with plugs at each end to which three tail fibers are anchored. These tail fibers appear to be involved in adsorption onto the host cell surface and are formed by one of the minor structural proteins.[citation needed]

SIRV1 and SIRV2 are stiff rods of about 23 nm in width, but differing in length—SIRV1 is about 830 nm and SIRV2 is about 900 nm long. They present a central channel of approx. 6 nm that encapsidates the DNA genome. At each terminus of the rod there is a plug of approx. 48 nm in length and 6 nm in diameter that fills the terminal portion of the cavity, together with three tail fibres of approx. 28 nm in length.[citation needed]

A three-dimensional reconstruction of the SIRV2 virion at ~4 angstrom resolution has been obtained by cryo–electron microscopy.[9] The structure revealed a previously unknown form of virion organization, in which the alpha-helical major capsid protein of SIRV2 wraps around the DNA, making it inaccessible to solvent. The viral DNA was found to be entirely in the A-form, which suggests a common mechanism with bacterial spores for protecting DNA in the most adverse environments.

Genome

[edit]
Genome organization of Stygiolobus rod-shaped virus (SRV), Sulfolopbus islandicus rod-shaped virus 1 (SIRV1) and Acidianus rod-shaped virus 1 (ARV1)

The genome is composed of linear dsDNA and ranges from 24 kb (ARV1) to 35 kb (SIRV2). The two strands of the linear genomes are covalently linked and, at both ends of the genome, there are inverted terminal repeats. The Sulfolobus rudiviruses size up to 32.3 kbp for SIRV1 and 35.8 kbp for SIRV2, with inverted terminal repeats of 2029 bp at the ends of the linear genome. The G+C content of both genomes is extremely low, of only 25%, whereas the genome of Sulfolobus solfataricus (the sequenced genome closest to the virus host) hits 37%.

Although the sequences of the inverted terminal repeats of the rudiviruses are different, they all carry the motif AATTTAGGAATTTAGGAATTT near the genome ends, which may constitute a signal for the Holliday junction resolvase[10] and DNA replication.

Transcriptional patterns and transcription regulation

[edit]

The transcriptional patterns of SIRV1 and SIRV2 are relatively simple, with few temporal expression differences.[11] In contrast, at least 10% of its genes were predicted to have of different DNA binding motifs in the proteins they code and were assigned to be putative transcriptional regulators.[12] A high proportion of viral genes coding for DNA binding proteins with the ribbon-helix-helix (RHH) DNA binding motifs has been suggested. The abundance of genes coding for proteins belonging to the RHH superfamily present in the genomes of crenarchaea and their viruses could underline the important role of these proteins in host and viral gene transcription regulation under harsh conditions.

Protein SvtR[13] was the first crenarchaeal RHH regulator characterized in details and also the first viral coded transcriptional regulators within the Archaeal domain. It strongly represses the transcription of the minor structural protein and, to a lesser extent, of its own gene. The structure is very similar to that of bacterial RHH proteins despite the low sequence similarity, such as CopG, a bacterial plasmid copy number control regulator.

A Sulfolobus islandicus coded transcription activator, Sta1, has also been shown to activate transcription of several viral genes.[14]

Viral life cycle

[edit]
SIRV-2 replication in Sulfolobus islandicus

SIRV2 recognizes its host by binding to type 4 pili abundantly present on the cell surface.[15][16] The virus initially binds to the tip of the pilus and subsequently advances along the pilus to the cell surface, where the virion disassembles and the SIRV2 genome is internalized by an unknown mechanism.[15] SIRV2 is a lytic virus that kills the host cell as a consequence of elaborated mechanisms orchestrated by the virus. Massive degradation of the host chromosomes occurs because of virus infection and virion assembly occurs in the cytoplasm. Virions are released from the host cell through a mechanism that involves the formation of specific cellular structures.[17]

Potential applications in nanotechnology

[edit]

SIRV2 can act as a template for site-selective and spatially controlled chemical modification. Both the ends and the body of the virus, or the ends only, can be chemically addressed, thus SIRV2 can be regarded as a structurally unique nanobuilding block.[18]

References

[edit]
  1. ↑ Zillig, W.; Prangishvili, D.; Schleper, C.; Elferink, M.; Holz, I.; Albers, S.; Janekovic, D.; Götz, D. (1996). "Viruses, plasmids and other genetic elements of thermophilic and hyperthermophilic Archaea". FEMS Microbiol. Rev. 18 (2–3): 225–236. doi:10.1111/j.1574-6976.1996.tb00239.x. PMID 8639330.
  2. ↑ Prangishvili, D.; Stedman, K.; Zillig, W. (2001). "Viruses of the extremely thermophilic archaeon Sulfolobus". Trends Microbiol. 9 (1): 39–43. doi:10.1016/s0966-842x(00)01910-7. PMID 11166242.
  3. 1 2 "Virus Taxonomy: 2020 Release". International Committee on Taxonomy of Viruses (ICTV). March 2021. Retrieved 14 May 2021.
  4. ↑ "ICTV Taxonomy history: Icerudivirus SIRV1". International Committee on Taxonomy of Viruses (ICTV). Retrieved 14 May 2021.
  5. ↑ "ICTV Taxonomy history: Icerudivirus SIRV2". International Committee on Taxonomy of Viruses (ICTV). Retrieved 14 May 2021.
  6. ↑ "ICTV Taxonomy history: Icerudivirus SIRV3". International Committee on Taxonomy of Viruses (ICTV). Retrieved 16 September 2023.
  7. ↑ "ICTV Taxonomy history: Icerudivirus". International Committee on Taxonomy of Viruses (ICTV). Retrieved 14 May 2021.
  8. ↑ Prangishvili, David; Peter Arnold, Hans; Götz, Dorothee; Ziese, Ulrike; Holz, Ingelore; Kristjansson, Jakob K.; Zillig, Wolfram (1999). "A Novel Virus Family, the Rudiviridae: Structure, Virus-Host Interactions and Genome Variability of the Sulfolobus Viruses SIRV1 and SIRV2". Genetics. 152 (4): 1387–1396. doi:10.1093/genetics/152.4.1387. PMC 1460677. PMID 10430569.
  9. ↑ DiMaio F, Yu X, Rensen E, Krupovic M, Prangishvili D, Egelman EH (2015). "A virus that infects a hyperthermophile encapsidates A-form DNA". Science. 348 (6237): 914–917. Bibcode:2015Sci...348..914D. doi:10.1126/science.aaa4181. PMC 5512286. PMID 25999507.
  10. ↑ Birkenbihl, R.P; Neef, K; Prangishvili, D; Kemper, B (2001). "Holliday junction resolving enzymes of archaeal viruses SIRV1 and SIRV2". Journal of Molecular Biology. 309 (5): 1067–76. doi:10.1006/jmbi.2001.4761. PMID 11399079.
  11. ↑ Kessler, Alexandra; Brinkman, Arie B.; John; Prangishvili, David (November 2004). "Transcription of the Rod-Shaped Viruses SIRV1 and SIRV2 of the Hyperthermophilic Archaeon Sulfolobus". J Bacteriol. 186 (22): 7745–7753. doi:10.1128/JB.186.22.7745-7753.2004. PMC 524901. PMID 15516589.
  12. ↑ Prangishvili, David; Garrett, Roger A.; Koonin, Eugene V. (2006). "Evolutionary genomics of archaeal viruses: Unique viral genomes in the third domain of life". Virus Research. 117 (1): 52–67. doi:10.1016/j.virusres.2006.01.007. PMID 16503363.
  13. ↑ Guilliere, Florence; Peixeiro, Nuno; Kessler, Alexandra; Raynal, Bertrand; Desnoues, Nicole; Keller, Jenny; Delepierre, Muriel; Prangishvili, David; Sezonov, Guennadi; Guijarro, J. Inaki (August 2009). "Structure, function and targets of the transcriptional regulator SvtR from the hyperthermophilic archaeal virus SIRV1". J Biol Chem. 284 (33): 22222–37. doi:10.1074/jbc.m109.029850. PMC 2755947. PMID 19535331.
  14. ↑ Kessler, Alexandra; Sezonov, Guennadi; Guijarro, J. Iñaki; Desnoues, Nicole; Rose, Thierry; Delepierre, Muriel; Bell, Stephen D.; Prangishvili, David (2006). "A novel archaeal regulatory protein, Sta1, activates transcription from viral promoters". Nucleic Acids Res. 34 (17): 4837–4845. doi:10.1093/nar/gkl502. PMC 1635249. PMID 16973899.
  15. 1 2 Quemin, ER; Lucas, S; Daum, B; Quax, TE; Kühlbrandt, W; Forterre, P; Albers, SV; Prangishvili, D; Krupovic, M (2013). "First insights into the entry process of hyperthermophilic archaeal viruses". Journal of Virology. 87 (24): 13379–85. doi:10.1128/JVI.02742-13. PMC 3838266. PMID 24089554.
  16. ↑ Wang, F; Cvirkaite-Krupovic, V; Kreutzberger, MAB; Su, Z; de Oliveira, GAP; Osinski, T; Sherman, N; DiMaio, F; Wall, JS; Prangishvili, D; Krupovic, M; Egelman, EH (2019). "An extensively glycosylated archaeal pilus survives extreme conditions". Nature Microbiology. 4 (8): 1401–1410. doi:10.1038/s41564-019-0458-x. PMC 6656605. PMID 31110358.
  17. ↑ Bize, Ariane; Karlsson, Erik A.; Ekefjärd, Karin; Quax, Tessa E. F.; Pina, Mery; Prevost, Marie-Christine; Forterre, Patrick; Tenaillon, Olivier; Bernander, Rolf; Prangishvili, David (2009). "A unique virus release mechanism in the Archaea". PNAS. 106 (27): 11306–11311. Bibcode:2009PNAS..10611306B. doi:10.1073/pnas.0901238106. PMC 2708744. PMID 19549825.
  18. ↑ Steinmetz, N.F., Bize, A., Findlay, K.C., Lomonossoff, G.P., Manchester, M., Evans, D.J. and Prangishvili, D. (2008) Site-specific and spatially controlled addressability of a new viral nanobuilding block: Sulfolobus islandicus rod-shaped virus 2. Adv. Funct. Mater. 18, 3478–3486
[edit]
  • Wikimedia Commons logo Media related to Icerudivirus at Wikimedia Commons