Wikipedia:Reference desk/Archives/Computing/2010 June 2
| Computing desk | ||
|---|---|---|
| < June 1 | << May | June | Jul >> | June 3 > |
| Welcome to the Wikipedia Computing Reference Desk Archives |
|---|
| The page you are currently viewing is an archive page. While you can leave answers for any questions shown below, please ask new questions on one of the current reference desk pages. |
June 2
[edit]Round corners for IE
[edit]the moz-border-radius quality only works in Firefox. I'm working on a website for kids, who will likely be using IE6 to 8. Can I make round corners show up for them at all? {{Sonia|talk|simple}} 00:16, 2 June 2010 (UTC)
- There are lots of ways, but they all involve using images of rounded corners. Here are a bunch of links relating to just this question. --Mr.98 (talk) 00:31, 2 June 2010 (UTC)
- (edit conflict) Yes. In fact, this question is so frequently asked, there's an entire article on MSDN about it. (Furthermore, when IE9 rolls around, it will support the CSS3 standard border-radius property and no hacks will be necessary to make rounded corners work across up-to-date browsers.) « Aaron Rotenberg « Talk « 00:36, 2 June 2010 (UTC)
- IE9 preview does support
border-radius; see {{round corners}}. ---— Gadget850 (Ed) talk 00:54, 2 June 2010 (UTC)
- IE9 preview does support
- I wonder, how does the following atrocity behave on IE6? -- Finlay McWalter • Talk 01:00, 2 June 2010 (UTC)
- Work laptop still has IE6 ;) I see a green rectangle with a curved left border. Sandman30s (talk) 06:40, 2 June 2010 (UTC)
- I don't know about IE6, but it works in IE8. However, I think I just died a little inside. Putting it near children, as the OP intends, is probably unwise. « Aaron Rotenberg « Talk « 05:46, 2 June 2010 (UTC)
- Good God. That's.... a very scary way to make round corners, but it admittedly works. I don't really want images, so the best it appears I can do is something like this: , which is not ideal, but works. :P {{Sonia|talk|simple}} 07:24, 2 June 2010 (UTC)
- I don't even see why you guys are saying it's an atrocity! That's awesome! Comet Tuttle (talk) 22:31, 2 June 2010 (UTC)
- Good God. That's.... a very scary way to make round corners, but it admittedly works. I don't really want images, so the best it appears I can do is something like this: , which is not ideal, but works. :P {{Sonia|talk|simple}} 07:24, 2 June 2010 (UTC)
Safari 'Tabs'
[edit]A while ago someone kindly advised me how to create a tab for a web page, but I have mislaid it, can anyone help please? Thanks in anticipation.--Artjo (talk) 08:26, 2 June 2010 (UTC)
- Sorry, but I don't really understand. Are you trying to create a website with 'tabs' or are you browsing the Internet and want to use tabs? If so, you can right-hand click on a link and choose 'Open link in new tab' to do so, or you can go Command->T on a Mac or Ctrl->T on a Windows computer to open a new blank tab. Chevymontecarlo 12:30, 2 June 2010 (UTC)
- I'm not sure what you mean, but if you mean how to set an html link top open in a new tab? If so, that's still under the browser's control. Adding the property target="_blank" to the A tag asks the browser to open in a new window or tab - which they choose is up to the browser's settings. CSS3 adds the target-new property, but the browsers I've tried don't seem to support it. -- Finlay McWalter • Talk 14:36, 2 June 2010 (UTC)
- If, however, you want a web page to look like it's got tabs within it, then you'd typically use a JavaScript UI client library with support for tab controls built in. Many of the full-featured toolkits do just this, including jQuery, Yahoo! UI Library , and Dojo . -- Finlay McWalter • Talk 14:36, 2 June 2010 (UTC)
- Thanks all, great stuff, know how to do it now ie:Command -> T on my Mac.--Artjo (talk) 14:50, 2 June 2010 (UTC)
Why Mac Address alone is not Sufficient ? why do we need IP Address ?
[edit]As Mac Address is 48 bits why it can alone be used to address the internet , why we need IP ? —Preceding unsigned comment added by R.srinivaas (talk • contribs) 09:38, 2 June 2010 (UTC)
- To make routing tractable. MAC addresses are assigned by equipment manufacturers and thenceforth remain static. The process of selling and distributing equipment essentially shuffles all the equipment around, so there's no pattern to them. The IP devices in your home, or in your street, have an essentially random salad of MAC addresses. Now when you send a packet out, it goes to your ISP's router. If routing was done by randomly-distributed MACs, each router in the world would need a comprehensive list of every IP enabled device, in order to know where to send the packet. Its routing table would look like this:
- 80:00:00:00:01 send_to_entanet
- 80:00:00:00:02 send_to_google
- 80:00:00:00:03 send_to_level3
- 80:00:00:00:04 send_to_bt
- 80:00:00:00:05 send_to_google
- 80:00:00:00:06 send_to_bt
- 80:00:00:00:07 send_to_cableandwireless
- That whole table would be vast, with hundreds of millions of entries. And every time a dynamic node (a cellphone or a laptop, say) moved, you'd have to update every router in the world with the routing information. The internet would be clogged with vast updates for these massive routing tables. So that's not what is done - instead IPs are assigned, and those IPs are strongly correlated with the network toplogy. So a routing table can consist of ranges, and you can do all the work with a few tens or hundreds of entries. Such a table looks like:
- 71.30.0.0-71.33.255.255 send_to_entanet
- 71.34.0.0-71.40.255.255 send_to_level3
- with each entry covering thousands, sometimes millions of addresses. Your scheme works fine on very small networks (indeed, that's how ethernet switches decide where to send packets on their local VLAN) but it doesn't scale. -- Finlay McWalter • Talk 09:56, 2 June 2010 (UTC)
Hi, how many computers does one have to run so that the use of Windows Server Update Services makes sense, as opposed to updating each computer manually (by setting all but your testbed computers to auto-download, but not auto-install, and walking around/RDPing to install the downloaded patches once you have verified their compatibility on your testbed computers)? I mean, doing manual updates on a bunch of computers does take a while, but maintaining a WSUS server takes time, too (and I'm guessing time-consuming errors can happen both ways, be it by manually installing a patch by accident that hasn't been tested yet, or a WSUS-managed machine failing to report back to the WSUS server, requiring manual fix-up) - so where's the break-even? Is there an official Microsoft recommendation, or at least some sort of rule-of-thumb? -- 109.193.27.65 (talk) 10:36, 2 June 2010 (UTC)
The PDF article tells me that the combination of Inkscape plus Poppler would let me edit PDF files. I have a Windows computer. Installing Inkscape is easy. Poppler, however, looks like it's for Linux. Googling for "poppler windows binaries" or similar takes me to pages that either are inscrutable or that seem to assume I'm using something called Calibre. Any tips for a befuddled non-expert? Tama1988 (talk) 11:13, 2 June 2010 (UTC)
- Have you tried just using Inkscape? My version of it can import/export PDFs without using Poppler already. I suspect the article is out of date, saying that it requires Poppler. --Mr.98 (talk) 12:54, 2 June 2010 (UTC)
- You're right, it works well. Thank you for the tip. Incidentally, I should have read the article more closely; it suggested that Inkscape used Poppler rather than that the "end user" had to make a conscious decision to use Poppler. Tama1988 (talk) 07:49, 4 June 2010 (UTC)
Code cracking...
[edit]From the synthetic genome Craig Venter recently made (well, published), there are 4 regions which encode some kind of code. I've tried cracking them, but as a biologist failed miserably. Any experts out there want to have a go?
| Lengthy code hidden. ╟─TreasuryTag►sundries─╢ 18:15, 2 June 2010 (UTC) |
|---|
| The following discussion has been closed. Please do not modify it. |
|
TTAACTAGCTAAGTTCGAATATTTCTATAGCTGTACATATTGTAATGCTGATAACTAATACTGTGCGCTTGACTGTGATCCTGATAAATAACTTCTTCTGTAGGGTAGAGTTTTATTTAAGGCTACTCACTGGTTGCAAACCAATGCCGTACATTACTAGCTTGATCCTTGGTCGGTCATTGGGGGATATCTCTTACTAATAGAGCGGCCTATCGCGTATTCTCGCCGGACCCCCCTCTCCCACACCAGCGGTGTAGCATCACCAAGAAAATGAGGGGAACGGATGAGGAACGAGTGGGGGCTCATTGCTGATCATAATGACTGTTTATATACTAATGCCGTCAACTGTTTGCTGTGATACTGTGCTTTCGAGGGCGGGAGATTCGTTTTTGACATACATAAATATCATGACAAAACAGCCGGTCATGACAAAACAGCCGGTCATAATAGATTAGCCGGTGACTGTGAAACTAAAGCTACTAATGCCGTCAATAAATATGATAATAGCAACGGCACTGACTGTGAAACTAAAGCCGGCACTCATAATAGATTAGCCGGAGTCGTATTCATAGCCGGTAGATATCACTATAAGGCCCAGGATCATGATGAACACAGCACCACGTCGTCGTCCGAGTTTTTTTGCTGCGACGTCTATACCACGGAAGCTGATCATAAATAGTTTTTTTGCTGCGGCACTAGAGCCGGACAAGCACACTACGTTTGTAAATACATCGTTCCGAATTGTAAATAATTTAATTTCGTATTTAAATTATATGATCACTGGCTATAGTCTAGTGATAACTACAATAGCTAGCAATAAGTCATATATAACAATAGCTGAACCTGTGCTACATATCCGCTATACGGTAGATATCACTATAAGGCCCAGGACAATAGCTGAACTGACGTCAGCAACTACGTTTAGCTTGACTGTGGTCGGTTTTTTTGCTGCGACGTCTATACGGAAGCTCATAACTATAAGAGCGGCACTAGAGCCGGCACACAAGCCGGCACAGTCGTATTCATAGCCGGCACTCATGACAAAACAGCGGCGCGCCTTAACTAGCTAA TTAACTAGCTAACAACTGGCAGCATAAAACATATAGAACTACCTGCTATAAGTGATACAACTGTTTTCATAGTAAAACATACAACGTTGCTGATAGTACTCCTAAGTGATAGCTTAGTGCGTTTAGCATATATTGTAGGCTTCATAATAAGTGATATTTTAGCTACGTAACTAAATAAACTAGCTATGACTGTACTCCTAAGTGATATTTTCATCCTTTGCAATACAATAACTACTACATCAATAGTGCGTGATATGCCTGTGCTAGATATAGAACACATAACTACGTTTGCTGTTTTCAGTGATATGCTAGTTTCATCTATAGATATAGGCTGCTTAGATTCCCTACTAGCTATTTCTGTAGGTGATATACGTCCATTGCATAAGTTAATGCATTTAACTAGCTGTGATACTATAGCATCCCCATTCCTAGTGCATATTTTCATCCTAGTGCTACGTGATATAATTGTACTAATGCCTGTAGATAATTTAATGCCTGGCTCGTTTGTAGGTGATAATTTAGTGCCTGTAAAACATATACCTGAGTGCTCGTTGCGTGATAGTTCGTTCATGCATATACAACTAGGCTGCTGTGATATGGTCACTGCCCTTACTGTGCTACATATTACTGCGAGGGGGATGACGTATAAACCTGTTGTAAGTGATATGACGTATATAACTACTAGTGATATGACGTATAGGCTAGAACAACGTGATATGACGTATATGACTACTGTCCCAAACATCAGTGATATGACGTATACTATAATTTCTATAATAGTGATAAATAAACCTGGGCTAAATACGTTCCTGAATACGTGGCATAAACCTGGGCTAACGAGGAATACCCATAGTTTAGCAATAAGCTATAGTTCGTCATTTTTAAGGCGCGCCTTAACTAGCTAA TTAACTAGCTAATTTAACCATATTTAAATATCATCCTGATTTTCACTGGCTCGTTGCGTGATATAGATTCTACTGTAGTGCTAGATAGTTCTGTACTAGGTGATACTATAGATTTCATAGATAGCACTACTGGCTTCATGCTAGGCATCCCAATAGCTAGTGATAGTTTAGTGCATACAACGTCATGTGATACAACGTTGCTGGCTGTAGATACAACGTCGTATTCTGTAAGTGATACAATAGCTATTGCTGTGCATAGGCCTATAGTGGCTGTAACTAGTGATATCACGTAACAACCATATAAGTTAGATTTAATGCCCCTGACTGAACGCTCGTTGCGTGATAGTTTAGGCTCGTTGCATACAACTGTGATTTTCATAAAACAACGTGATAATTTAGTGCTAGATAAGTTCCGCTTAGCAAGTGATAGTTTCCGCTTGACTGTGCATAGTTCGTTCATGCGCTCGTTGCGTGATAAACTAGGCAGCTTCACAACTGATAATTTAATTGCTGATATTGCTGGCTGTCTAGTGCTAGTGATCATAGTGCGTGATAGTTTAAGCTGCTCTGTTTTAGATATCACGTGCTTGATAATGAAACTAACTAGTGATACTACGTAGTTAACTATGAATAGGCCTACTGTAAATTCAATAGTGCGTGATATTGAACTAGATTCTGCAACTGCTAATATGCCGTGCTGCACGTTTGGTGATAGTTTAGCATGCTTCACTATAATAAATATGGTAGTTGTAACTACTGCGAATAGGGGGAGCTTAATAAATATGATCACTGTGCTACGCTATATGCCGTTGAATATAGGCTATATGATCATAACATATATAGCTATAAGTGATAAGTTCCTGAATATAGGCTATATGATCATAACATATACAACTGTACTCATGAATAAGTTAACGAGGATTAACTAGCTAA TTAACTAGCTAATTTCATTGCTGATCACTGTAGATATAGTGCATTCTATAAGTCGCTCCCACAGGCTAGTGCTGCGCACGTTTTTCAGTGATATTATCCTAGTGCTACATAACATCATAGTGCGTGATAAACCTGATACAATAGGTGATATCATAGCAACTGAACTGACGTTGCATAGCTCAACTGTGATCAGTGATATAGATTCTGATACTATAGCAACGTTGCGTGATATTTTCACTACTGGCTTGACTGTAGTGCATATGATAGTACGTCTAACTAGCATAACTAGTGATAGTTATATTTCTATAGCTGTACATATTGTAATGCTGATAACTAGTGATATAATCCAACTAGATAGTCCTGAACTGATCCCTATGCTAACTAGTGATAAACTAACTGATACATCGTTCCTGCTACGTGATAGCTTCACTGAGTTCCATACATCGTCGTGCTTAAACATCAGTGATAACACTATAGAGTTCATAGATACTGCATTAACTAGTGATATGACTGCAAATAGCTTGACGTTTTGCAGTCTAAAACAACGTGATAATTCTGTAGTGCTAGATACTATAGATTTCCTGCTAAGTGATAAGTCTACTGATTTACTAATGAATAGCTTGGTTTTGGCATACACTGTGCGCTGCACTGGTGATAGCTTTTCGTTGATGAATAATTTCCCTAGCACTGTGCGTGATATGCTAGATTCTGTAGATAGGCTAAATTCGTCTACGTTTGTAGGTGATAGTTTAGTTGCTGTAACTAATATTATCCCTGTGCCGTTGCTAAGCTGTGATATCATAGTGCTGCTAGATATGATAAGCAAACTAATAGAGTCGAGGGGGAGTCTCATAGTGAATACTGATATTTTAGTGCTGCCGTTGAATAAGTTCCCTGAACATTGTGATACTGATATTTTAGTGCTGCCGTTGAATATCCTGCATTTAACTAGCTTGATAGTGCATTCGAGGAATACCCATACTACTGTTTTCATAGCTAATTATAGGCTAACATTGCCAATAGTGCGGCGCGCCTTAACTAGCTAA |
Here are some clues: "encoded in the watermarks is a new DNA code for writing words, sentences and number that includes a web address to send emails to if you can successfully decode the new code.
It also includes the names of 46 authors and other key contributors and three quotations: “To live, to err, to fall, to triumph, to recreate life out of life” from James Joyce; “See things not as they are, but as they might be” from the book American Prometheus; and “What I cannot build, I cannot understand” from Richard Feynman."
Cheers, have fun!
Aaadddaaammm (talk) 12:10, 2 June 2010 (UTC)
- I can give you some hints (based in part on an interview I heard with Venter). In the interview he said that they wanted to make sure that their "code" didn't actually produce anything worthwhile when processed by the ribosome. I don't know enough about proteinogenic amino acid synthesis to know whether this means we can reject some triplet codons as being proteinogenic in a eukaryote. If there are some that can, it would be tempting to use that population (of triplet-codons) as a simple alphabet (you need 26, plus a few for .,:/ . If there aren't, I guess you'd have to figure out how they prevent proteinogenesis from occuring (I guess lots of stop codons, or something clever based on RNA interference). One might imagine that a molecular biologist would want to base their alphabet on codons rather than just a string of base-pairs, but if they want upper- and lower-case, they'll need a broader "byte" than the 64 options a 3-codon gives them. Once you know the ciphertext alphabet that's available, the coding itself shouldn't be too hard - it's mostly a caesar cipher, but you'll probably find that they code adjacent letters with logically adjacent codons (so 'A' might code as AAA, 'B' as AAC, 'C' as AAG, etc.). And the web address gives a nice crib - if it starts with http://, then you have a repeat followed by two dissimilar letters followed by another repeat. -- Finlay McWalter • Talk 16:08, 2 June 2010 (UTC)
- Thanks for the tips, I just figured it out myself - using the quotes as a "crib" (especially the word CANNOT). I didn't see any pattern in the codon:letter arrangements, but wasn't really looking. Aaadddaaammm (talk) 16:17, 2 June 2010 (UTC)
- (ec)And the plaintexts have plenty more cribs, such as the repeated " life" in the Joyce quote, repeated " as they" in the Prometheus quote, and repeated " cannot " in the Feynman quote (including the spaces in all, assuming Venter's code does store spaces). I think these fairly length repetitions, with known spaces between them, will be the key to figuring it out. -- Finlay McWalter • Talk 16:18, 2 June 2010 (UTC)
/dev/random and OpenBSD
[edit]I know openbsd has /dev/random, but does it behave the same as it does in Linux? If I try sudo cat /dev/random I get an Input/output error. Is this normal? /dev/urandom works fine. Shadowjams (talk) 16:44, 2 June 2010 (UTC)
- This page says that /dev/random only works if you have a real hardware random number generator, while the other /dev/?random devices are for various weaker alternatives. --Sean 18:29, 2 June 2010 (UTC)
- Perfect, that explains it. Even feels vaguely familiar. Shadowjams (talk) 20:11, 2 June 2010 (UTC)
creating or assmebling a Pdf document using free software
[edit]In this country, some explicitely ask for the Job application as a single pdf document. It usually contains covering letter, resume and scanned certificates. I tried that using word - pasted one image per page and wrote an index, linked them using hyperlink. Yes, Ms word isnt free, but my university has it, although i cannot install any software or even a word plugin. When i convert this doc to pdf using a free online tool, link does not exist. Layout is damaged too - certain image titles appear on the previous pages. I tried options such as putting the image caption and image in a two row table or using "image description" in word, neither worked. First two sections are largely ok, since it is almost entirely text. Please advice how to create a pdf document that does not have distorted pages and with linked index for certifcates. —Preceding unsigned comment added by 134.99.136.3 (talk) 17:04, 2 June 2010 (UTC)
- Have you tried Scribd or Google Docs - they both have pretty high quality doc->pdf conversion, something other programs aren't so good on. I don't know how they handle indices, however. -- Finlay McWalter • Talk 17:09, 2 June 2010 (UTC)
If you can install printers on any system with a word processor, then PDF Creator is the perfect option. It's what I use, basically you send any document to print, but instead of selecting library canon black-and-white or whatever, you select a PDF option. And it's open-source. ╟─TreasuryTag►senator─╢ 17:13, 2 June 2010 (UTC)
- Similarly, I use CutePDF Writer, which is freeware. You "print" to a PDF file. If I were in your situation, I'd go straight to the person in charge of the computers there and explain your need. Comet Tuttle (talk) 17:37, 2 June 2010 (UTC)
- But on the downside, "CutePDF Writer" has an unbearably twee name ;) ╟─TreasuryTag►CANUKUS─╢ 17:39, 2 June 2010 (UTC)
- Agreed, and there's confusion with CuteFTP, which I also use. Cuteness abounds on my machine. Comet Tuttle (talk) 18:11, 2 June 2010 (UTC)
- But on the downside, "CutePDF Writer" has an unbearably twee name ;) ╟─TreasuryTag►CANUKUS─╢ 17:39, 2 June 2010 (UTC)
- See List of PDF software. --Spoon! (talk) 19:50, 2 June 2010 (UTC)
- If you can print to PostScript you can then try Ghostscript. If the computer has access to any printers, there's a fair chance they use PostScript so you can try these although you'll be limited to whatever options the printer supports. Ghostscript doesn't need to be installed although you obviously need to be able to run it on some computer. BTW, Microsoft Office 2007 SP2 and 2010 come with a built-in PDF creator. This is also available for earlier versions of Office 2007 but wasn't installed by default because of legal problems with Adobe. If your uni is using Word 2007, I'm surprised they haven't already upgraded to SP2 but you could ask them to install the addin (or upgrade to SP2 which has been out for over a year!). When it is installed, look in the save as for a save as PDF option. Nil Einne (talk) 20:07, 2 June 2010 (UTC)
- The best way of doing what you want to do is to write the application from the beginning in LaTeX. Then you just use the pdflatex command to produce your final PDF file. The "hyperref" package will allow you to put in the hyperlinks.
- But I have to admit that by "best" I mean "best if you already know how to do it". If you don't, there's a fairly large amount of material you need to learn. Possibly worth it on the grounds that you can then use LaTeX again, but it's a large task that you may not have time or attention to deal with in the middle of a job search. --Trovatore (talk) 20:14, 2 June 2010 (UTC)
- Your last statements are correct, Trovatore; the advice to use LaTeX is bad advice for this querent, who just wants to use Word to save a job application as a PDF. Comet Tuttle (talk) 20:34, 2 June 2010 (UTC)
- We don't know that. It's entirely possible that the knowledge of a superior typesetting system will be advantageous to him in the future. I'm just laying out the options (LaTeX is better, but it is a fair amount of work to learn) and leaving it up to him. --Trovatore (talk) 20:54, 2 June 2010 (UTC)
- Your last statements are correct, Trovatore; the advice to use LaTeX is bad advice for this querent, who just wants to use Word to save a job application as a PDF. Comet Tuttle (talk) 20:34, 2 June 2010 (UTC)
problem adding to a home network
[edit]I have an existing wired/wireless home network that has three XP desktops. I got a Windows 7 laptop and I'm trying to add that to the network, via wireless. The new laptop connects fine and it sees the rest of the computers. The XP computers don't quite see it. On the new laptop, I told it to share, etc.
On the XP desktops, under Network Places/Entire network/MS windows network, there is 1. MShome - the old network name - it shows the old computers 2. workgroup - this is new. It shows the name of the new laptop, but there is no "+" beside it, and the other computers can't open it.
How can I get the old XP desktops to see the new W7 laptop on the network? Bubba73 (You talkin' to me?), 20:05, 2 June 2010 (UTC)
- Are you sure the Windows 7 laptop firewall is not blocking connections? I believe the 'wizard' (if you used that) should automatically add an exception but it probably pays to check it in any case. If this doesn't help, do you know the IP and/or computer name (not workgroup name!) of the hew computer? Workgroup sounds more like the workgroup name. If you do, try manually visiting the computer, e.g. \\bubba73comp1 or \\192.168.0.97 You might as well set the workgroup name to be the same unless you have a reason for it to be different as well although this shouldn't case problems initself. P.S. When you say you told it to share I presume you're actually sharing something right? Nil Einne (talk) 20:12, 2 June 2010 (UTC)
- The easiest is to make sure all of them are using the same workgroup. So change MSHOME to WORKGROUP or vis versa. Alternatively you can use the "\\COMPUTERNAME\" syntax in the address bar of any normal folder window. If you have firewalls running they could interfere with it too unless you set them up (I think the default windows firewall does not need to be specifically setup). Shadowjams (talk) 20:14, 2 June 2010 (UTC)
- I don't know how to change WORKGROUP to MSHOME (it must have been the default.
- I had both Windows and Norton Firewall on - always a bad idea. I turned Windows Firewall off in 3 places (domain, public, private). I told Norton to turn off the firewall too, but I have the same problem. Bubba73 (You talkin' to me?), 21:24, 2 June 2010 (UTC)
- Unless you want the Norton firewall, I would uninstall. Norton I believe is one of the firewalls known to still cause problems even when it's supposed to be disabled. I doubt it's what's causing the problems here but I would do it. If you want to change the workgroup name in Windows 7, go to the Control Panel and type 'workgroup' into the search bar and choose the obvious option. In Windows XP try the System properties (it's actually the same place but XP lacks the search bar). Anyway I'd recommend you find out the name of the computer (again Control Panel then type in 'computer name' in the search bar, you can actually see and change the name and workgroup starting from here too) and try the \\ recommended by me and Shadowjams and see if that works. Nil Einne (talk) 01:05, 3 June 2010 (UTC)
- I uninstalled Norton. I changed the workgroup name to match, but now the laptop doesn't see the others properly. They show up but it can't access them ("not accessible") and it gives the message "not enough server storage...". The one I;m trying to access has 4GB of RAM and plenty of HD space. Bubba73 (You talkin' to me?), 02:08, 3 June 2010 (UTC)
- I asked here because the Microsoft newsgroup ended. But perhaps MS Forums would be a better place to ask. Bubba73 (You talkin' to me?), 02:09, 3 June 2010 (UTC)
- Looks like you already did it, but just so we're on the same page, to change the workgroup, rightclick on My Computer, go to properties, then go to Computer Name, and then click on the Change button. Have you tried using the "\\192.168.0.1" (replace the right IP there) method? Does that work? Shadowjams (talk) 02:26, 3 June 2010 (UTC)
- I asked here because the Microsoft newsgroup ended. But perhaps MS Forums would be a better place to ask. Bubba73 (You talkin' to me?), 02:09, 3 June 2010 (UTC)
- From a quick search it seems something has messed up your computer settings, possibly Norton AV (I'm reminded again of why I really dislike Norton products). I'm not sure why it happened now, perhaps the Norton Firewall stops the Norton AV from messing up the computer settings (actually on second thought, maybe Norton Firewall allows the network to work with the IRPStackSize set low)? Anyway see which also describe how to fix this. Incidentally have you tried connecting to the laptop to see if we at least fixed that? P.S. I would personally try the MS forums or some other more specialised forums myself for this sort of thing if I couldn't resolve it myself Nil Einne (talk) 02:25, 3 June 2010 (UTC)
- I'll look at those links tomorrow (bedtime now). I posted on the MS networking newsgroup, but then I learned that they basically ended 6/1. Then I posted on MS forums. Ten people have viewed my message, but no reply so far. Bubba73 (You talkin' to me?), 05:28, 3 June 2010 (UTC)
I'm getting help from the MS forums and the firewall tech support. Bubba73 (You talkin' to me?), 19:06, 3 June 2010 (UTC)
Find the contents of a div in arbitrary html using javascript
[edit]Hi all,
I'm trying to write a JavaScript function that, when handed a string of HTML, will look for a div with an id and hand me back the contents of it. For instance, if I'm looking for the id "test," and I give it the string "<div id="test">wooo</div>" it should return"wooo."
I was originally writing this using a regex, but it started to look complicated, and I knew that there already existed javascript functions for DOM parsing. The only problem is, this isn't HTML that is actually on the page -- it's just coming from an arbitrary string, and I don't want to have to stick that into the DOM.
Any thoughts? Thanks! — Sam 63.138.152.135 (talk) 20:56, 2 June 2010 (UTC)
- You need comething along the lines of document.getElementById("test").innerHTML. A search for "javascript getelementbyid innerHTML" should yield various use examples. -- Tom N (tcncv) talk/contrib 23:46, 2 June 2010 (UTC)
- Except
document.getElementById()uses DOM, and the OP doesn't want to limit himself/herself to relying on DOM. Your original idea, with RegExp, is the way to go. For your example above, see the code below:
- Except
var str; //your HTML string
var innerhtml = null;
var position = str.search(/id="test"/im); //search for the id and get its position in the string
for(var i = position; i < str.length; i++) {
if(str.charAt(i) == ">") { //you found the start of the inner HTML
var oneChar;
while((oneChar = str.charAt(i++)) != "<") { //get each character till you get to the end tag (hopefully there are no <'s in-between!)
innerhtml += oneChar; //and add it to your result variable
}
break; // stop looking
}
}
if(innerhtml != null) {
//print innerhtml or do whatever you planned with it
//...
}
else {
//no match was found
}
I don't write a lot of javascript, so there may be some small errors, but you get the idea.--el Aprel (facta-facienda) 02:11, 3 June 2010 (UTC)
- Thanks a lot for that! I'm not sure that's the best way, though, in part because of the requirement that the innerHTML have no tags. But it looks like some clever lateral thinking! In the end, I found a much simpler regex:
var pattern = /<div id='test'>(.*?)<\/div>/;
var matches = article.match(pattern);
var testInnerHTML = matches[1];
- It could be spruced up with some fancier regexing for the div itself, incase it isn't as precise as that, but this is good for my purposes. Thanks so much anyway! — Sam 63.138.152.135 (talk) 14:21, 3 June 2010 (UTC)
Citation highlighting
[edit]I'm not exactly sure where to ask this particular question, so I'll ask here.
I've seen that on another site using MediaWiki citations work differently. Mainly, what I want to know is how the text is highlighted, like when you click on [1] and it highlights the citation that it jumps to. If anyone could explain, that would be great.
Just to confirm, the site in question uses the same citation extension as Wikipedia (with ref tags). Killr 22:00, 2 June 2010 (UTC)
- See Help:Cite messages and ask me anything you don't understand. ---— Gadget850 (Ed) talk 22:44, 2 June 2010 (UTC)
Program with Templates
[edit]I need to compile a yearbook, using templates for articles and templates for pictures. The picture templates should be able to use word art on or around the pictures. So I should be able to take raw camera pictures and crop them into shapes, etc. Does anyone know of the best software (or multiple programs) for this task? Free is not a must, but I'd prefer it. Thanks in advance! Mxvxnyxvxn (talk) 23:35, 2 June 2010 (UTC)