Euplotid nuclear code
The euplotid nuclear code (translation table 10) is the genetic code used by Euplotidae. The euplotid code is a socalled "symmetrical code", which results from the symmetrical distribution of the codons. This symmetry allows for arythmic exploration of the codon distribution. In 2013, shCherbak and Makukov, reported that "the patterns are shown to match the criteria of an intelligent signal."[1]
The code
[edit]AAs = FFLLSSSSYY**CCCWLLLLPPPPHHQQRRRRIIIMTTTTNNKKSSRRVVVVAAAADDEEGGGGStarts = -----------------------------------M----------------------------Base1 = TTTTTTTTTTTTTTTTCCCCCCCCCCCCCCCCAAAAAAAAAAAAAAAAGGGGGGGGGGGGGGGGBase2 = TTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGBase3 = TCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAG
Bases: adenine (A), cytosine (C), guanine (G) and thymine (T) or uracil (U).
Amino acids: Alanine (Ala, A), Arginine (Arg, R), Asparagine (Asn, N), Aspartic acid (Asp, D), Cysteine (Cys, C), Glutamic acid (Glu, E), Glutamine (Gln, Q), Glycine (Gly, G), Histidine (His, H), Isoleucine (Ile, I), Leucine (Leu, L), Lysine (Lys, K), Methionine (Met, M), Phenylalanine (Phe, F), Proline (Pro, P), Serine (Ser, S), Threonine (Thr, T), Tryptophan (Trp, W), Tyrosine (Tyr, Y), Valine (Val, V)
Differences from the standard code
[edit]| DNA codons | RNA codons | This code (10) | Standard code (1) | |
|---|---|---|---|---|
TGA | UGA | Cys (C) | STOP = Ter (*) |
Systematic range
[edit]See also
[edit]References
[edit]This article incorporates text from the United States National Library of Medicine, which is in the public domain. [3]
- ↑ shCherbak, Vladimir I.; Makukov, Maxim A. (May 2013). "The 'Wow! signal' of the terrestrial genetic code". Icarus. 224 (1): 228–242. arXiv:1303.6739. Bibcode:2013Icar..224..228S. doi:10.1016/j.icarus.2013.02.017. S2CID 16507813.
- ↑ D. C. Hoffman; R. C. Anderson; M. L. DuBois; D. M. Prescott (25 April 1995). "Macronuclear gene-sized molecules of hypotrichs". Nucleic Acids Res. 23 (8): 1279–83. doi:10.1093/nar/23.8.1279. PMC 306850. PMID 7753617.
- ↑ Elzanowski A, Ostell J, Leipe D, Soussov V. "The Genetic Codes". Taxonomy browser. National Center for Biotechnology Information (NCBI), U.S. National Library of Medicine. Retrieved 19 March 2016.